X Tutup
Skip to content

Latest commit

 

History

History
 
 

Folders and files

NameName
Last commit message
Last commit date

parent directory

..
 
 
 
 
 
 
 
 

Counting DNA Nucleotides

In this exercise, we’ll count the frequency of the four nucleotide bases in a given string of DNA as described on the Rosalind.info site[1] Write a Python program called dna.py that will accept a single, required, positional argument that is a string of dna and print the number of times you see each of the bases A, C, G, and T (in that order) separated by spaces.

The program should print a brief usage when run with no input:

$ ./dna.py
usage: dna.py [-h] str
dna.py: error: the following arguments are required: str

Or a longer usage for the -h or --help flags:

$ ./dna.py -h
usage: dna.py [-h] str

Count DNA nucleotides

positional arguments:
  str         DNA

optional arguments:
  -h, --help  show this help message and exit

Examples of running:

$ ./dna.py A
1 0 0 0
$ ./dna.py C
0 1 0 0
$ ./dna.py G
0 0 1 0
$ ./dna.py T
0 0 0 1
$ ./dna.py AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21

A passing test suite looks like this:

$ make test
pytest -xv test.py
============================= test session starts ==============================
...
collected 11 items

test.py::test_exists PASSED                                              [  9%]
test.py::test_no_arg_and_usage PASSED                                    [ 18%]
test.py::test_a_upper PASSED                                             [ 27%]
test.py::test_a_lower PASSED                                             [ 36%]
test.py::test_c_upper PASSED                                             [ 45%]
test.py::test_c_lower PASSED                                             [ 54%]
test.py::test_g_upper PASSED                                             [ 63%]
test.py::test_g_lower PASSED                                             [ 72%]
test.py::test_t_upper PASSED                                             [ 81%]
test.py::test_t_lower PASSED                                             [ 90%]
test.py::test_rosalind_example PASSED                                    [100%]

============================== 11 passed in 0.61s ==============================
Note
Solve this problem using only the skills you’ve learned up to chapter 3 — that is, only using Python str methods.

1. This is a website with various bioinformatics coding challenges. It’s named after Rosalind Franklin who should have gotten a Nobel Prize for her work on discovering the double-helix structure of DNA. Instead, she died early with little recognition of her contributions, but she did get this website named after her.
X Tutup